python - ValueError: too many values too unpack (expected 2) -


i'm trying parse dna strings.

the input.txt contains:

rosalind_6404cctgcggaagatcggcactagaatagccagaaccgtttctctgaggcttccggccttccctcccactaataattctgagg>rosalind_5959ccatcggtagcgcatccttagtccaattaagtccctatccaggcgctccgccgaaggtctatatccatttgtcagcagacacgc>rosalind_0808ccaccctcgtggtatggctaggcattcaggaaccggagaacgcttcagaccagcccggactgggaacctgcgggcagtaggtggaat

the code is: 

f = open('input.txt', 'r') raw_samples = f.readlines() f.close() samples = {} cur_key = '' elem in raw_samples:     if elem[0] == '>':         cur_key = elem[1:].rstrip()         samples[cur_key] = ''     else:         samples[cur_key] = samples[cur_key] + elem.rstrip() print(samples) p_id, s in samples.values():     samples[s_id] = (s.count('g') + s.count('c'))*100 print (samples)`

i keep getting error:

  file "c:/python34/test.py", line 18, in <module>     p_id, s in samples.values(): valueerror: many values unpack (expected 2)

i able solve problem changing for p_id, s in samples.values() for p_id, s in samples.items()

i noticed p_id , s_id different, meant same.


Comments

Post a Comment

Popular posts from this blog

jquery - How do you format the date used in the popover widget title of FullCalendar? -

Image
in fullcalendar, how format date used in popover widget title when clicking '+n more'? code: <div class="fc-popover fc-more-popover"> <div class="fc-header fc-widget-header"> <span class="fc-close fc-icon fc-icon-x"></span> <span class="fc-title">tuesday, april 7</span> ... </div> ... </div> you use daypopoverformat that. determines date format of title of popover created eventlimitclick option. must date formatting string. default value "dddd, mmmm d" english , "ll" other languages.
Read more

Bubble Sort Manually a Linked List in Java -

Image
this first question here. trying manually sort linked list of integers in java , can not figure out wrong code. suggestions? don't error, still have output unordered. tried few different ways, nothing worked. appreciate if can me that. public class node { int data; node nextnode; public node(int data) { this.data = data; this.nextnode = null; } public int getdata() { return this.data; } } // node class public class datalinkedlist implements datainterface { private node head; private int size; public datalinkedlist(){ this.head = null; this.size = 0; } public void add(int data) { node node = new node(data); if (head == null) { head = node; } else { node currentnode = head; while(currentnode.nextnode != null) { currentnode = currentnode.nextnode; } currentnode.nextnode = node; ...
Read more

asp.net mvc - SSO between MVCForum and Umbraco7 -

i need integrate sso between mvcforum (forum of company) , umbraco7 (manages cms company). however struggling shared authentication work. tried several ways suggested on other threads still not running expected. here did: 1. in mvcforum (forum.mywebsite.com) 1.1. machine key in web.xml: <machinekey validationkey="the same key umbraco7" decryptionkey="the same key umbraco7" validation="sha1" decryption="aes" /> 1.2. authenticate forms in web.xml <forms name="my-sso-auth" protection="all" path="/" timeout="43200" domain="forum.mywebsite.com" loginurl="/members/logon" enablecrossappredirects="true" /> 2. in umbraco7 (news.mywebsite.com) 2.1. machine key in web.xml: <machinekey validationkey="the same key mvcforum" decryptionkey="the same key mvcforum" validation="sha1" decryption="aes" /> 2.2. a...
Read more