python - ValueError: too many values too unpack (expected 2) -


i'm trying parse dna strings.

the input.txt contains:

rosalind_6404cctgcggaagatcggcactagaatagccagaaccgtttctctgaggcttccggccttccctcccactaataattctgagg>rosalind_5959ccatcggtagcgcatccttagtccaattaagtccctatccaggcgctccgccgaaggtctatatccatttgtcagcagacacgc>rosalind_0808ccaccctcgtggtatggctaggcattcaggaaccggagaacgcttcagaccagcccggactgggaacctgcgggcagtaggtggaat

the code is:

f = open('input.txt', 'r') raw_samples = f.readlines() f.close() samples = {} cur_key = '' elem in raw_samples:     if elem[0] == '>':         cur_key = elem[1:].rstrip()         samples[cur_key] = ''     else:         samples[cur_key] = samples[cur_key] + elem.rstrip() print(samples) p_id, s in samples.values():     samples[s_id] = (s.count('g') + s.count('c'))*100 print (samples)` 

i keep getting error:

  file "c:/python34/test.py", line 18, in <module>     p_id, s in samples.values(): valueerror: many values unpack (expected 2) 

i able solve problem changing for p_id, s in samples.values() for p_id, s in samples.items()

i noticed p_id , s_id different, meant same.


Comments

Popular posts from this blog

shopping cart - Page redirect not working PHP -

php - How to modify a menu to show sub-menus -

python - Installing PyDev in eclipse is failed -